ENSDARG00000088218

Ensembl ID:
ENSDARG00000088218

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30405 Nonsense Mutation detected in F1 DNA During 2017
sa44414 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129246 Nonsense 257 328 8 8
Genomic Location (Zv9):
Chromosome Zv9_NA609 (position 1114)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6543012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACAGAAATTGAAAAAGGTGGTTGTGGAGACCCAGGCGTCCCTGCATA[T/A]GGAAAGCGAACTGGAGATCGTTTTTTACACGGTGATGTGCTGACCTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129246 Nonsense 275 328 8 8
Genomic Location (Zv9):
Chromosome Zv9_NA609 (position 1060)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6543066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCGAACTGGAGATCGTTTTTTACACGGTGATGTGCTGACCTTTGAGTG[T/A]CAGGCAGCTTTCGAATTGGTTGGCGAGAGGACAATATCATGCCAACAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link