ENSDARG00000088214

Ensembl ID:
ENSDARG00000088214

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20296 Nonsense Mutation detected in F1 DNA During 2016
sa10173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122690 Nonsense 118 400 2 5
Genomic Location (Zv9):
Chromosome 4 (position 28282116)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 29019922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATTTCAGCATATCATCATCCCTTAATCAACACATGTTGATCCACACT[G/T]GAGAAAAACCATTCACTTGCACTCAGTGTGGGAAGAGTTTCAGCCAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122690 Nonsense 236 400 2 5
Genomic Location (Zv9):
Chromosome 4 (position 28282472)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 29020278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTTAATCAAYACATGAGGATCCACACTGGAGAGAAACCATTCACATG[C/A]ACTCAGTGTGGAAGGGGTTTTAACTGCTTATCAAACCTTAAACAAYACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link