ENSDARG00000088214

Ensembl ID:
ENSDARG00000088214

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20296 Nonsense Mutation detected in F1 DNA During 2014
sa3502 Nonsense Mutation detected in F1 DNA During 2014
sa10173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122690 Nonsense 118 400 2 5
Genomic Location:
Chromosome 4 (position 28282116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATTTCAGCATATCATCATCCCTTAATCAACACATGTTGATCCACACT[G/T]GAGAAAAACCATTCACTTGCACTCAGTGTGGGAAGAGTTTCAGCCAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122690 Nonsense 189 400 2 5
Genomic Location:
Chromosome 4 (position 28282331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGAGAGAAACCATTCACATGCAATCAGTGTGGGAAGAGTTTTAACTG[C/A]TTAACACACCTTAATCAACATATGAGGATCCACACCGGAGAGAAACCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122690 Nonsense 236 400 2 5
Genomic Location:
Chromosome 4 (position 28282472)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTTAATCAAYACATGAGGATCCACACTGGAGAGAAACCATTCACATG[C/A]ACTCAGTGTGGAAGGGGTTTTAACTGCTTATCAAACCTTAAACAAYACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gn7kgcxs