SHISA8 (1 of 2)

Ensembl ID:
ENSDARG00000088204
Description:
shisa homolog 8 (Xenopus laevis) [Source:HGNC Symbol;Acc:18351]
Human Orthologues:
SHISA8, SHISA9
Human Descriptions:
shisa homolog 8 (Xenopus laevis) [Source:HGNC Symbol;Acc:18351]
shisa homolog 9 (Xenopus laevis) [Source:HGNC Symbol;Acc:37231]
Mouse Orthologue:
Shisa9
Mouse Description:
shisa homolog 9 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1919805]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22075 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126300 Nonsense 290 431 5 5
Genomic Location (Zv9):
Chromosome 12 (position 19822135)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18674296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCTCCCTAACAGCTGACACTGCAAACCGGAGCTACTACAAGAGTTA[T/A]CCACTGATGGACTTCTCCCAGCATCATTCCCCTCCTGTAGCTTTCCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link