ENSDARG00000088197

Ensembl ID:
ENSDARG00000088197
Human Orthologues:
TAF4, TAF4B
Human Descriptions:
TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa [Source:HGNC Symbol
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa [Source:HGNC Symbo
Mouse Orthologues:
Taf4a, Taf4b
Mouse Descriptions:
TAF4A RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Ac
TAF4B RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15594 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126760 Essential Splice Site 292 439 1 4
Genomic Location:
Chromosome 13 (position 52366568)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGCAGACCACCAWCCAGCTGCCACCCGGGTTCACCATCCCACCAGG[T/C]ACCCAGAGCTTTCTCATTATTGCCCACTGCTGTCTGCTCTGACTGCAWTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lj0btlx3