MPPED1

Ensembl ID:
ENSDARG00000088181
Description:
metallophosphoesterase domain containing 1 [Source:HGNC Symbol;Acc:1306]
Human Orthologue:
MPPED1
Human Description:
metallophosphoesterase domain containing 1 [Source:HGNC Symbol;Acc:1306]
Mouse Orthologue:
Mpped1
Mouse Description:
metallophosphoesterase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:106316]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14958 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129983 Nonsense 5 192 1 4
Genomic Location:
Chromosome 4 (position 7952910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACTCTATCACAACAGCTGCTTTCTCTTWCCTCAGGCACTCTGCCCTA[C/A]GAGATAAAAATCGTCATCRCCGGCAACCACGAGCTGACGTTCGACCAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h3ikoia2