LOC564072

Ensembl ID:
ENSDARG00000088178

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14202 Essential Splice Site Available for shipment Available now
sa10143 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125731 Essential Splice Site 74 158 2 3
Genomic Location:
Chromosome 11 (position 26199215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTGTCAAACACTGAGATTTGTGCTGCCAGCTTGGTCAGCGAGGCGAG[G/A]TAAATTCACYACATCTGCTCAGAGACTGCAGTCGGGATCACTTTATTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125731 Nonsense 150 158 3 3
Genomic Location:
Chromosome 11 (position 26199558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYCAGCGTCTTCCACAACACTTCTCTCGCAWRCASCGCATGGTCCTYCAC[C/T]AGCCTGGCCGATGCAACTTTAATCATTAAGATGCAACGAGTAYGCAAACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jx0hfd1b