ablim3

Ensembl ID:
ENSDARG00000088168
ZFIN ID:
ZDB-GENE-070112-1122
Description:
Novel protein similar to vertebrate actin binding LIM protein family, member 3 (ABLIM3, zgc:158673)
Human Orthologue:
ABLIM3
Human Description:
actin binding LIM protein family, member 3 [Source:HGNC Symbol;Acc:29132]
Mouse Orthologue:
Ablim3
Mouse Description:
actin binding LIM protein family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2442582]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa306 Nonsense Confirmed mutation in F2 line During 2014
sa184 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa306
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125109 None None 183 None 5
ENSDART00000141157 Nonsense 177 681 4 22
ENSDART00000147084 None None 132 None 6

The following transcripts of ENSDARG00000088168 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 35826693)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCTCTGCTGGCGTTGGAGAAGCAGTGGCACGTCAGCTGCTTCAGGTG[T/A]CAGACCTGCGGCCTCGTCCTGACCGGAGAGTATATCAGCAAGTGAGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa184
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125109 Nonsense 31 183 1 5
ENSDART00000141157 Nonsense 328 681 9 22
ENSDART00000147084 None None 132 None 6

The following transcripts of ENSDARG00000088168 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 35805829)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAAGGTTAAAGCCATTTATGAAGTGCAGAGGCCAGACTACTGGTCCTA[T/A]GAGTCGAGTCACAGATACTGCTCCGATGACAGGCTAGAGCGCCTCAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/325z14tw