ENSDARG00000088167

Ensembl ID:
ENSDARG00000088167
Human Orthologue:
SH2D2A
Human Description:
SH2 domain containing 2A [Source:HGNC Symbol;Acc:10821]
Mouse Orthologue:
Sh2d2a
Mouse Description:
SH2 domain protein 2A Gene [Source:MGI Symbol;Acc:MGI:1351596]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16543 Nonsense Available for shipment Available now
sa40907 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127358 Nonsense 75 434 2 6
Genomic Location (Zv9):
Chromosome 7 (position 30630742)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29023084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTAGTACAGTAACTWTCGCTGTTTGCAGGGAAGCAGARGATCAGCTC[A/T]GAGACAGGGATGTTGGATGCTTCCTTATCAGACTCAGCGAGAAAGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127358 Splice Site, Nonsense 223 434 4 6
Genomic Location (Zv9):
Chromosome 7 (position 30633107)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29025449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAATCGGAAGCTCACAACCTCCACCTCTATTGACAGGAACAGCCTGTCT[C/T]AGGTAACAATGTCAACTACTTCCTTGGATACAATCTATGCTTTTTTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link