BAI2 (1 of 3)

Ensembl ID:
ENSDARG00000088161
Description:
brain-specific angiogenesis inhibitor 2 [Source:HGNC Symbol;Acc:944]
Human Orthologue:
BAI2
Human Description:
brain-specific angiogenesis inhibitor 2 [Source:HGNC Symbol;Acc:944]
Mouse Orthologue:
Bai2
Mouse Description:
brain-specific angiogenesis inhibitor 2 Gene [Source:MGI Symbol;Acc:MGI:2451244]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18072 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130846 Essential Splice Site 300 623 2 8
Genomic Location:
Chromosome 19 (position 40546803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGAGGCCACGATCGGCTGACCAGCCAGGTGTGTTTCAGGCACAGACTGG[T/G]GAGTCTCATTGTCTAGATGCATTTYGCTTAAATGCACTTCAGAACCATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pmxg2xww