BAI2 (1 of 3)

Ensembl ID:
ENSDARG00000088161
Description:
brain-specific angiogenesis inhibitor 2 [Source:HGNC Symbol;Acc:944]
Human Orthologue:
BAI2
Human Description:
brain-specific angiogenesis inhibitor 2 [Source:HGNC Symbol;Acc:944]
Mouse Orthologue:
Bai2
Mouse Description:
brain-specific angiogenesis inhibitor 2 Gene [Source:MGI Symbol;Acc:MGI:2451244]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36892 Nonsense Mutation detected in F1 DNA During 2016
sa18072 Essential Splice Site Available for shipment Available now
sa43330 Nonsense Mutation detected in F1 DNA During 2016
sa36891 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130846 Nonsense 298 623 2 8
Genomic Location:
Chromosome 19 (position 40546811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGACGCAGAGGCCACGATCGGCTGACCAGCCAGGTGTGTTTCAGGCA[C/T]AGACTGGTGAGTCTCATTGTCTAGATGCATTTCGCTTAAATGCACTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130846 Essential Splice Site 300 623 2 8
Genomic Location:
Chromosome 19 (position 40546803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGAGGCCACGATCGGCTGACCAGCCAGGTGTGTTTCAGGCACAGACTGG[T/G]GAGTCTCATTGTCTAGATGCATTTYGCTTAAATGCACTTCAGAACCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130846 Nonsense 358 623 4 8
Genomic Location:
Chromosome 19 (position 40510617)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTTTTTCTTTTTGCGTGCCTCTGTGGTTGTGTTTGCAGTGGAAGGT[C/T]AATGGTTGGACTGGGCCACCTGGTCTCAGTGCTCTGTCTCCTGCGGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130846 Nonsense 573 623 8 8
Genomic Location:
Chromosome 19 (position 40494604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCTCCTGGAGTTAATGTCCCGTAAGAATTATTACAGTGGAGACCTCT[T/A]ATTCTCCGTGGAGATTCTCCGAAATGTGACAGACACCTTCAAGCGAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link