ENSDARG00000088154

Ensembl ID:
ENSDARG00000088154
Human Orthologues:
BOC, CDON
Human Descriptions:
Boc homolog (mouse) [Source:HGNC Symbol;Acc:17173]
Cdon homolog (mouse) [Source:HGNC Symbol;Acc:17104]
Mouse Orthologues:
Boc, Cdon
Mouse Descriptions:
biregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein Gene [S
cell adhesion molecule-related/down-regulated by oncogenes Gene [Source:MGI Symbol;Acc:MGI:1926387]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30386 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129328 Nonsense 63 121 2 2
Genomic Location (Zv9):
Chromosome Zv9_scaffold3556 (position 63561)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 390222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTTCTGGACTGTCAGGCCGGAGGCGAGTCTCCCGTAAGCGTACGTTG[G/A]CGGAAAAACGGCGTCCAGATCCAAGAGAGCGAGTGTGTGCGCTTGCTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link