si:dkey-191l12.1

Ensembl ID:
ENSDARG00000088146
ZFIN ID:
ZDB-GENE-091204-146
Human Orthologue:
R3HCC1
Human Description:
R3H domain and coiled-coil containing 1 [Source:HGNC Symbol;Acc:27329]
Mouse Orthologue:
R3hcc1
Mouse Description:
R3H domain and coiled-coil containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919093]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6167 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127533   None 467 None 10
ENSDART00000138524 Essential Splice Site None 186 1 8
Genomic Location (Zv9):
Chromosome 10 (position 20426877)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20435563
KASP Assay ID:
554-5206.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACGAGTTRATGTTTGTCATTGGTTCTCTGATATACTTCGCTTTTTCTT[G/A]TAAGTTCACTTTAAGTTACACTAAAATAACTTTTTAAGTGCCTCAGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link