SEMA4G (2 of 2)

Ensembl ID:
ENSDARG00000088143
Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Human Orthologue:
SEMA4G
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4g
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22148 Nonsense Available for shipment Available now
sa31888 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131181 Nonsense 4 809 1 15
Genomic Location (Zv9):
Chromosome 12 (position 35358608)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33761713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTTTTTCTAACTGGGTCTCTCTCGCTGTTTTGCAGGGCTGCTGGGTTG[T/A]AATCATTTCCAAGGAGCCGCATTGAACTACAGCTCTCTGCTACTGGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131181 Nonsense 540 809 14 15
Genomic Location (Zv9):
Chromosome 12 (position 35328798)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33732113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCACCGAACACGTGCGGTGATGGCAGGAGATGATGTGCTGCTACAATG[C/A]GAGATTCGATCAAACCTGGCCACCCCTCAATGGACGCTGAACAGTCAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link