GPR64 (1 of 2)

Ensembl ID:
ENSDARG00000088137
Description:
G protein-coupled receptor 64 [Source:HGNC Symbol;Acc:4516]
Human Orthologue:
GPR64
Human Description:
G protein-coupled receptor 64 [Source:HGNC Symbol;Acc:4516]
Mouse Orthologue:
Gpr64
Mouse Description:
G protein-coupled receptor 64 Gene [Source:MGI Symbol;Acc:MGI:2446854]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44149 Nonsense Mutation detected in F1 DNA During 2016
sa18671 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127342 Nonsense 157 947 2 15
Genomic Location (Zv9):
Chromosome 24 (position 25909021)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25155809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAACAGACTTGGCAATAAACACAACTGCTATGCCAGTTAATGTAACGT[T/A]GAACACAACAGATTCCCCATTCAATACAACACAATCAAACACAACAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127342 Nonsense 503 947 6 15
Genomic Location (Zv9):
Chromosome 24 (position 25903174)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25149962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAAGAAGCTGAATAGCTACATTCTGGGCTCTAGCGTGGCTAACCTGT[C/A]AATCAGAAACCTGAGAGAGAACATAGAGTTTACTCTGATGAATAAGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link