LOC100006877

Ensembl ID:
ENSDARG00000088131

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44080 Missense Mutation detected in F1 DNA During 2016
sa25207 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130245 Missense 3 228 1 4
Genomic Location:
Chromosome 24 (position 6416340)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTAAAATCATTATGACAGCTGATTTGTATTGTTATTTATAGATGCCT[T/A]TTTCAAACAACGAGAAATCAGCTCGTCACAGAGCAAAGGTGAATGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130245 Nonsense 36 228 2 4
Genomic Location:
Chromosome 24 (position 6415805)
KASP Assay ID:
554-7724.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGACATCTTAAAACACTTTCTTATTGTTTAACGCTTTCAGCTATCAG[C/T]GAAGGAAGAGGGAAGGAAAGACAAAACTTTCTTCAGTCACCGAACTCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link