ENSDARG00000088127

Ensembl ID:
ENSDARG00000088127

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28012 Nonsense Mutation detected in F1 DNA During 2015
sa30966 Nonsense Mutation detected in F1 DNA During 2015
sa6273 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa28012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122637 Nonsense 5 249 1 5
Genomic Location:
Chromosome 12 (position 45791438)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTAAAACAAAGTCGCAGGTTTGAAATCACCACTGATGTGCTGTTTTT[C/A]GGGTTTCGTCTTTCTTAGGTACCCTTTCCCGACGGTCTTCAGCACGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122637 Nonsense 99 249 2 5
Genomic Location:
Chromosome 12 (position 45798890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGAAGGAGGAGGCCGTCTGTGCTCATGGACAGTGTTGTGAAAACTG[T/A]CAGGTAAATGCTGAAGTTTGCATGTTCTCTCCGTGTCCGCGTGGGTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122637 Nonsense 211 249 5 5
Genomic Location:
Chromosome 12 (position 45807172)
KASP Assay ID:
554-4224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTCCTCCTGTTKTTTTCCAGAGATGCCAAATGTGGGAAGATCCAGTG[T/A]CAGGGTGGAGCCAACCGGCCGGYRATAGGCACCAATGCYGTTTCCATTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5x9rsjwy