ENSDARG00000088125

Ensembl ID:
ENSDARG00000088125
Human Orthologues:
C16orf5, LITAF
Human Descriptions:
chromosome 16 open reading frame 5 [Source:HGNC Symbol;Acc:13234]
lipopolysaccharide-induced TNF factor [Source:HGNC Symbol;Acc:16841]
Mouse Orthologues:
5730403B10Rik, Litaf
Mouse Descriptions:
LPS-induced TN factor Gene [Source:MGI Symbol;Acc:MGI:1929512]
RIKEN cDNA 5730403B10 gene Gene [Source:MGI Symbol;Acc:MGI:1913876]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20122 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20121 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123317 Essential Splice Site 48 190 1 5
Genomic Location:
Chromosome 3 (position 46413070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGCCATGCTCATTCAGTTCAAGAAAAACAACGGGCAAAACGAGCAAC[G/A]TCAGTATGATCAGATCGAACCAAATAATTGTTTGCTTTTTAATGATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123317 Nonsense 125 190 4 5
Genomic Location:
Chromosome 3 (position 46409039)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTATTTTGGATGTTCGGCAACTTCCTCCACAACCATCTCTAACACAGTG[T/A]CCATTCTGTCAGCAGTTTATAACTACAGATGTCTCAACCCAAGTTGGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q0dfw9go