ENSDARG00000088125

Ensembl ID:
ENSDARG00000088125
Human Orthologues:
C16orf5, LITAF
Human Descriptions:
chromosome 16 open reading frame 5 [Source:HGNC Symbol;Acc:13234]
lipopolysaccharide-induced TNF factor [Source:HGNC Symbol;Acc:16841]
Mouse Orthologues:
5730403B10Rik, Litaf
Mouse Descriptions:
LPS-induced TN factor Gene [Source:MGI Symbol;Acc:MGI:1929512]
RIKEN cDNA 5730403B10 gene Gene [Source:MGI Symbol;Acc:MGI:1913876]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44574 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa20122 Essential Splice Site Available for shipment Available now
sa20121 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123317 Splice Site, Nonsense 49 190 1 5
Genomic Location (Zv9):
Chromosome 3 (position 46413071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGGCCATGCTCATTCAGTTCAAGAAAAACAACGGGCAAAACGAGCAA[C/T]GTCAGTATGATCAGATCGAACCAAATAATTGTTTGCTTTTTAATGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123317 Essential Splice Site 48 190 1 5
Genomic Location (Zv9):
Chromosome 3 (position 46413070)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48422623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGCCATGCTCATTCAGTTCAAGAAAAACAACGGGCAAAACGAGCAAC[G/A]TCAGTATGATCAGATCGAACCAAATAATTGTTTGCTTTTTAATGATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123317 Nonsense 125 190 4 5
Genomic Location (Zv9):
Chromosome 3 (position 46409039)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48418592
KASP Assay ID:
2259-4014.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTATTTTGGATGTTCGGCAACTTCCTCCACAACCATCTCTAACACAGTG[T/A]CCATTCTGTCAGCAGTTTATAACTACAGATGTCTCAACCCAAGTTGGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link