ENSDARG00000088121

Ensembl ID:
ENSDARG00000088121
Human Orthologues:
AC092718.1, PKDREJ
Human Description:
polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea ur
Mouse Orthologues:
Pkd1l2, Pkd1l3, Pkdrej
Mouse Descriptions:
polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-li
polycystic kidney disease 1 like 2 Gene [Source:MGI Symbol;Acc:MGI:2664668]
polycystic kidney disease 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:2664670]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21132 Nonsense Available for shipment Available now
sa41072 Nonsense Mutation detected in F1 DNA During 2016
sa41073 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124969 Nonsense 63 702 2 15
Genomic Location (Zv9):
Chromosome 7 (position 69159320)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67037341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGATGTTTGTTGTCTTTCTCAGAGCTCTGTGATGGACACCAGGTTTG[C/A]ACGGCTGATGTTTCGTCTTTCGGAGAACCGTGTCCTGCGCTAGGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124969 Nonsense 396 702 10 15
Genomic Location (Zv9):
Chromosome 7 (position 69179836)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67057857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCTGATCAGGAGCCTGCGGTCATCAGCACTACAAATCTTAACATCTA[T/A]GCCAACAGGTACGGACAATCAGAATACAAATCATATTTTTCATTAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124969 Essential Splice Site 399 702 10 15
Genomic Location (Zv9):
Chromosome 7 (position 69179845)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67057866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGCCTGCGGTCATCAGCACTACAAATCTTAACATCTATGCCAACAG[G/A]TACGGACAATCAGAATACAAATCATATTTTTCATTAATGAAAAATTATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link