ENSDARG00000088119

Ensembl ID:
ENSDARG00000088119
Human Orthologues:
SLC27A2, SLC27A5
Human Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 [Source:HGNC Symbol;Acc:10996]
solute carrier family 27 (fatty acid transporter), member 5 [Source:HGNC Symbol;Acc:10999]
Mouse Orthologues:
Slc27a2, Slc27a5
Mouse Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:1347099]
solute carrier family 27 (fatty acid transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1347100]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44340 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123999 Essential Splice Site 326 622 10 16
Genomic Location (Zv9):
Chromosome 25 (position 33263850)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31874353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGCAGTACATCGGAGAAACCTTACGCTACCTCTGCAATACGCCACAG[G/A]TAAATAGGCTTGTCACTGCCTAAACGTACAGATGCTTCTTACATATATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link