mmp16a

Ensembl ID:
ENSDARG00000088118
ZFIN ID:
ZDB-GENE-070820-1
Human Orthologue:
MMP16
Human Description:
matrix metallopeptidase 16 (membrane-inserted) [Source:HGNC Symbol;Acc:7162]
Mouse Orthologue:
Mmp16
Mouse Description:
matrix metallopeptidase 16 Gene [Source:MGI Symbol;Acc:MGI:1276107]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37920 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123794 Essential Splice Site 51 249 2 5
Genomic Location (Zv9):
Chromosome 24 (position 32814723)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31673380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGATGCCGTCTATGAAAACAGCAAGGGAAAATTTGTGTTCTTTAAAG[G/A]TAAGACTTCTGCACGTCAGATCAGTTTATTTAGAAGCGTTGACCAATGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link