LOC100331714

Ensembl ID:
ENSDARG00000088117
Human Orthologue:
FUT8
Human Description:
fucosyltransferase 8 (alpha (1,6) fucosyltransferase) [Source:HGNC Symbol;Acc:4019]
Mouse Orthologue:
Fut8
Mouse Description:
fucosyltransferase 8 Gene [Source:MGI Symbol;Acc:MGI:1858901]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15676 Essential Splice Site Available for shipment Available now
sa23819 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123851 Essential Splice Site 68 581 1 11
Genomic Location:
Chromosome 20 (position 50967147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGAAGCAGCAGAATGAAGACCTACGTCGCATGGCTCAGTCRTTACGG[T/C]AAATWCACATATNNNNNNNNNCGCTCTTAGGGGCYRTTCACACTTTTAAATTCTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123851 Nonsense 426 581 10 11
Genomic Location:
Chromosome 20 (position 51053974)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTTCTCTTGATATAATATTTGCTGGTGTTTTTCAGGTACACTGATTA[C/A]GAGTTCATTAGTGATAACTCCATCTCCTGGTCGGCCAGTTTACACAACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o4j9nqkh