gstm3

Ensembl ID:
ENSDARG00000088116
ZFIN ID:
ZDB-GENE-050309-24
Description:
glutathione S-transferase M3 (brain) [Source:RefSeq peptide;Acc:NP_001156323]
Human Orthologues:
GSTM1, GSTM2, GSTM3, GSTM4, GSTM5
Human Descriptions:
glutathione S-transferase mu 1 [Source:HGNC Symbol;Acc:4632]
glutathione S-transferase mu 2 (muscle) [Source:HGNC Symbol;Acc:4634]
glutathione S-transferase mu 3 (brain) [Source:HGNC Symbol;Acc:4635]
glutathione S-transferase mu 4 [Source:HGNC Symbol;Acc:4636]
glutathione S-transferase mu 5 [Source:HGNC Symbol;Acc:4637]
Mouse Orthologues:
AC156984.1, AC161511.1, Gstm1, Gstm2, Gstm3, Gstm4, Gstm5, Gstm6, Gstm7
Mouse Descriptions:
glutathione S-transferase, mu 1 Gene [Source:MGI Symbol;Acc:MGI:95860]
glutathione S-transferase, mu 2 Gene [Source:MGI Symbol;Acc:MGI:95861]
glutathione S-transferase, mu 3 Gene [Source:MGI Symbol;Acc:MGI:106026]
glutathione S-transferase, mu 4 Gene [Source:MGI Symbol;Acc:MGI:95862]
glutathione S-transferase, mu 5 Gene [Source:MGI Symbol;Acc:MGI:1309466]
glutathione S-transferase, mu 6 Gene [Source:MGI Symbol;Acc:MGI:1309467]
glutathione S-transferase, mu 7 Gene [Source:MGI Symbol;Acc:MGI:1915562]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31656 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046182 Nonsense 94 122 5 5
ENSDART00000145316 Nonsense 94 219 5 8

The following transcripts of ENSDARG00000088116 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26156956)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25284874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATTTTGTTGTAATGGGAATGTTTCTAGGTGGGGAAACTGAAGAAGAA[C/T]AGACCAGAGTTGACATCTTGGAGAATCAGGCGATGGACTTCCGCAATGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bladder cancer: A multi-stage genome-wide association study of bladder cancer identifies multiple susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link