ENSDARG00000088112

Ensembl ID:
ENSDARG00000088112
Human Orthologues:
GPR114, GPR56, GPR97
Human Descriptions:
G protein-coupled receptor 114 [Source:HGNC Symbol;Acc:19010]
G protein-coupled receptor 56 [Source:HGNC Symbol;Acc:4512]
G protein-coupled receptor 97 [Source:HGNC Symbol;Acc:13728]
Mouse Orthologues:
Gpr114, Gpr56, Gpr97
Mouse Descriptions:
G protein-coupled receptor 114 Gene [Source:MGI Symbol;Acc:MGI:2685955]
G protein-coupled receptor 56 Gene [Source:MGI Symbol;Acc:MGI:1340051]
G protein-coupled receptor 97 Gene [Source:MGI Symbol;Acc:MGI:1859670]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21123 Nonsense Available for shipment Available now
sa34226 Nonsense Mutation detected in F1 DNA During 2016
sa18201 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130064 Nonsense 117 625 3 13
Genomic Location (Zv9):
Chromosome 7 (position 66765734)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64680808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATCTTACAGCAGACACTACAACCAATTGTACTGTGGTTAAATGTTG[G/A]CCGGAAGAAATAAGTAACCTCCTGAAAACGAAAGAAAGTCAAATGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130064 Nonsense 491 625 11 13
Genomic Location (Zv9):
Chromosome 7 (position 66782248)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64697322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTCAGTTCATAACATCAGACCCTTTTATGGCACCCATGAGATGACAT[T/G]AACAGACACTGATCGGACCAATTCAATGTAAGTCTTCACATTACATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130064 Nonsense 551 625 12 13
Genomic Location (Zv9):
Chromosome 7 (position 66783229)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64698303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTAAAGCTRCATCGTACAAGTAGAAAGTWTGAAAAGATGCCAGTCTG[G/A]AAGGATGCCGGCACAGTGCTGGGGCTCATGTGTCTKCTGGGTACGACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link