KDM6B (1 of 2)

Ensembl ID:
ENSDARG00000088087
Description:
lysine (K)-specific demethylase 6B [Source:HGNC Symbol;Acc:29012]
Human Orthologue:
KDM6B
Human Description:
lysine (K)-specific demethylase 6B [Source:HGNC Symbol;Acc:29012]
Mouse Orthologue:
Kdm6b
Mouse Description:
KDM1 lysine (K)-specific demethylase 6B Gene [Source:MGI Symbol;Acc:MGI:2448492]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16587 Nonsense Available for shipment Available now
sa18869 Nonsense Mutation detected in F1 DNA During 2016
sa8805 Nonsense Mutation detected in F1 DNA During 2016
sa26939 Nonsense Mutation detected in F1 DNA During 2016
sa40872 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127719 Nonsense 81 1955 3 20
Genomic Location (Zv9):
Chromosome 7 (position 22933626)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21498811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATCTTTSTGTGTWTCCAGACCCATACATCGAGGGGATAAGCAAGAC[C/T]AGTCTCAGGCTTWGATGCCGGCATTGCAAAGAATGCCCCCTGCTCCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127719 Nonsense 85 1955 3 20
ENSDART00000127719 Nonsense 85 1955 3 20
Genomic Location (Zv9):
Chromosome 7 (position 22933639)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21498824
KASP Assay ID:
2259-8713.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCCAGACCCATACATCGAGGGGATAAGCAAGACCAGTCTCAGGCTT[T/A]GATGCCGGCATTGCAAAGAATGCCCCCTGCTCCTCCCAGGCCTTGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127719 Nonsense 85 1955 3 20
ENSDART00000127719 Nonsense 85 1955 3 20
Genomic Location (Zv9):
Chromosome 7 (position 22933639)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21498824
KASP Assay ID:
2259-8713.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTWTCCAGACCCATACATCGAGGGGATAAGCAAGACCAGTCTCAGGCTT[T/A]GATGCCGGCATTGCAAAGAATGCCCCCTGCTCCTCCCAGGCCWTGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127719 Nonsense 135 1955 3 20
Genomic Location (Zv9):
Chromosome 7 (position 22933788)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21498973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATTGCGCAATAGCTACAATGCAGGGCCTCCTTCACACCTTACAGCT[C/T]GAGCCAATCAGCTACTGAAGGTAAAAATTAGATGTTAATATCTTTACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127719 Essential Splice Site 280 1955 5 20
Genomic Location (Zv9):
Chromosome 7 (position 22935446)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21500631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCACCCTGGAACCCAACTGAACACAAAAGTGGACCCATTCATTTCCAG[G/A]TCTGCCGTCACTCATCAGAATTTATATTAAATTTTATTTTCTTCTATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link