KDM6B (1 of 2)

Ensembl ID:
ENSDARG00000088087
Description:
lysine (K)-specific demethylase 6B [Source:HGNC Symbol;Acc:29012]
Human Orthologue:
KDM6B
Human Description:
lysine (K)-specific demethylase 6B [Source:HGNC Symbol;Acc:29012]
Mouse Orthologue:
Kdm6b
Mouse Description:
KDM1 lysine (K)-specific demethylase 6B Gene [Source:MGI Symbol;Acc:MGI:2448492]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16587 Nonsense Available for shipment Available now
sa18869 Nonsense Mutation detected in F1 DNA During 2014
sa8805 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127719 Nonsense 81 1955 3 20
Genomic Location:
Chromosome 7 (position 22933626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATCTTTSTGTGTWTCCAGACCCATACATCGAGGGGATAAGCAAGAC[C/T]AGTCTCAGGCTTWGATGCCGGCATTGCAAAGAATGCCCCCTGCTCCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127719 Nonsense 85 1955 3 20
ENSDART00000127719 Nonsense 85 1955 3 20
Genomic Location:
Chromosome 7 (position 22933639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCCAGACCCATACATCGAGGGGATAAGCAAGACCAGTCTCAGGCTT[T/A]GATGCCGGCATTGCAAAGAATGCCCCCTGCTCCTCCCAGGCCTTGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127719 Nonsense 85 1955 3 20
ENSDART00000127719 Nonsense 85 1955 3 20
Genomic Location:
Chromosome 7 (position 22933639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTWTCCAGACCCATACATCGAGGGGATAAGCAAGACCAGTCTCAGGCTT[T/A]GATGCCGGCATTGCAAAGAATGCCCCCTGCTCCTCCCAGGCCWTGGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ecr0lg9z