LOC100149276

Ensembl ID:
ENSDARG00000088072
Human Orthologue:
USP43
Human Description:
ubiquitin specific peptidase 43 [Source:HGNC Symbol;Acc:20072]
Mouse Orthologue:
Usp43
Mouse Description:
ubiquitin specific peptidase 43 Gene [Source:MGI Symbol;Acc:MGI:2444541]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8117 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13909 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122735 Essential Splice Site 466 1183 7 15
Genomic Location:
Chromosome 3 (position 25693749)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTTGCTGGTGTGTAATGCCGCTGGAGCAGGACARCAGGCAGTGAGG[T/C]ACCRCACAAAATACTGACTGTATTTTGAGGTTGCAACTAAACAGTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122735 Nonsense 742 1183 13 15
Genomic Location:
Chromosome 3 (position 25663236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGAACTCGGTGGACGGTCAGTGGTACRCCTATGAKGACAGCAGTGTW[G/T]AACCCTTGCAGGAGGGAGAAGTGTGCACTCGCGCTGCTTATATCCTSTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/prosd5dv