LOC100149276

Ensembl ID:
ENSDARG00000088072
Human Orthologue:
USP43
Human Description:
ubiquitin specific peptidase 43 [Source:HGNC Symbol;Acc:20072]
Mouse Orthologue:
Usp43
Mouse Description:
ubiquitin specific peptidase 43 Gene [Source:MGI Symbol;Acc:MGI:2444541]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33175 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8117 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13909 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122735 Essential Splice Site 316 1183 4 15
Genomic Location:
Chromosome 3 (position 25702610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATCCTTTTCTGTGCATTTCTCTCCCCATTCCTCTAAGACAGACACGG[T/C]GAGTTAAATTCTGGCCAACAAAAGCATCTGAATCATGCAGGAATTTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122735 Essential Splice Site 466 1183 7 15
Genomic Location:
Chromosome 3 (position 25693749)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTTGCTGGTGTGTAATGCCGCTGGAGCAGGACARCAGGCAGTGAGG[T/C]ACCRCACAAAATACTGACTGTATTTTGAGGTTGCAACTAAACAGTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122735 Nonsense 742 1183 13 15
Genomic Location:
Chromosome 3 (position 25663236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGAACTCGGTGGACGGTCAGTGGTACRCCTATGAKGACAGCAGTGTW[G/T]AACCCTTGCAGGAGGGAGAAGTGTGCACTCGCGCTGCTTATATCCTSTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link