OTOA (2 of 2)

Ensembl ID:
ENSDARG00000088059
Description:
otoancorin [Source:HGNC Symbol;Acc:16378]
Human Orthologue:
OTOA
Human Description:
otoancorin [Source:HGNC Symbol;Acc:16378]
Mouse Orthologue:
Otoa
Mouse Description:
otoancorin Gene [Source:MGI Symbol;Acc:MGI:2149209]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11090 Nonsense Available for shipment Available now
sa12733 Nonsense Available for shipment Available now
sa7598 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124820 Nonsense 30 1020 1 8
Genomic Location:
Chromosome 7 (position 32733257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATCATAAYGTGAGTTGGTCTTTTGGACAGTCACTTCTGGATTTGTTTT[T/A]GGCTCCTGCAKATCCTTCTTGCAGTTTCACAAGTCTKGAATGCCAAGCKA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124820 Nonsense 76 1020 1 8
Genomic Location:
Chromosome 7 (position 32733394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGGACATTTCGACTTCTAGTCTCACTTGTGATCAACAAAACTTCAAC[C/T]AGCTCAATGAMACCCTTTGTGCATCAGTTTTATTGACAGCATCTCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124820 Missense 474 1020 1 8
Genomic Location:
Chromosome 7 (position 32734588)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTGAAAACTTCACTCGGAATGTATGTGTCAATGCTACAGTTCTGMAG[A/T]ATTTGCTGGCCAATTTAGACAACACCTGGTTGTTGGAACAATGCTCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gms5ptqv