fgf18a

Ensembl ID:
ENSDARG00000088048
ZFIN ID:
ZDB-GENE-030714-1
Description:
fibroblast growth factor 18a [Source:RefSeq peptide;Acc:NP_001013282]
Human Orthologue:
FGF18
Human Description:
fibroblast growth factor 18 [Source:HGNC Symbol;Acc:3674]
Mouse Orthologue:
Fgf18
Mouse Description:
fibroblast growth factor 18 Gene [Source:MGI Symbol;Acc:MGI:1277980]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24949 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123063 Essential Splice Site 119 207 6 6
Genomic Location:
Chromosome 14 (position 2184887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATGTTGTAGCTAACACGTTCGTTTCCATGCGCTCATTTGTGTCTCCT[A/G]GAAGGCCAGCAACCGTGGCGCCGACTGCGTCTTCATAGAGAAGGTTCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5hhaxtvk