LOC100332173

Ensembl ID:
ENSDARG00000088043
Human Orthologue:
WDR7
Human Description:
WD repeat domain 7 [Source:HGNC Symbol;Acc:13490]
Mouse Orthologue:
Wdr7
Mouse Description:
WD repeat domain 7 Gene [Source:MGI Symbol;Acc:MGI:1860197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37207 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078041 Nonsense 184 227 5 5
Genomic Location (Zv9):
Chromosome 21 (position 3110264)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2709735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATTGGGATGTTGAATTCGGCTCCTCAGCTGCGCTGCATTAAAACCTA[T/A]CAGGTCCCTCCGGTTCAGCCGGCGTCGCCCGGATCCCAGAACGCCCTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link