LOC100332709

Ensembl ID:
ENSDARG00000088041

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16887 Nonsense Available for shipment Available now
sa12630 Nonsense Available for shipment Available now
sa39068 Nonsense Mutation detected in F1 DNA During 2016
sa35994 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125511 Nonsense 117 802 4 6
Genomic Location (Zv9):
Chromosome 15 (position 42783163)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43961111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAATCTGAGCWGCAGAGCGAAATTCGGACAGAAGCAGAGATGGATGAA[G/T]AACCGAATGACAGAGAGATGGAWTTTCAGGATCAACAGAAYGAAGGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125511 Nonsense 269 802 5 6
Genomic Location (Zv9):
Chromosome 15 (position 42782415)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43960363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAGAGCATCGGCAGAGACGATCTGGCTGTAATCCTGAGAAAGACCTG[T/A]AGAAGAGGTACAGCAGCTTTACCACATCACCCGATAGATGATGSAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125511 Nonsense 633 802 6 6
Genomic Location (Zv9):
Chromosome 15 (position 42781209)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43959157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTATCGGATGATTCAAGAAGCACGGGATTATTTTACGGTGGACGATTTG[C/T]AAGCTGTTGGTCTGAAATACGATGATTTGAAATGTCGAGATGGATTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125511 Nonsense 789 802 6 6
Genomic Location (Zv9):
Chromosome 15 (position 42780739)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43958687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGAAAGACAGCCTGAACCCGGACCGCTACAAAAACCTGGAGCTGTG[T/A]CTGGTGGAGCTGGAGGAAGGCAAAGAGGAGGTCAGGAGATGAGGAGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link