ENSDARG00000088029

Ensembl ID:
ENSDARG00000088029
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10950 Nonsense Available for shipment Available now
sa14843 Nonsense Mutation detected in F1 DNA During 2016
sa13020 Nonsense Available for shipment Available now
sa36681 Nonsense Mutation detected in F1 DNA During 2016
sa2984 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa10950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064153 Nonsense 158 748 4 5
Genomic Location (Zv9):
Chromosome 18 (position 31401882)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33198741
KASP Assay ID:
2261-2344.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTMATTTCATAATTTATGCTTCCTGTTTGCAATAAMTTTTAGGTAAGTTA[T/A]TTTTCAACATGTGCGTGTCTCAGTGATAGAAAAAAATAWCCATYATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064153 Nonsense 171 748 4 5
Genomic Location (Zv9):
Chromosome 18 (position 31401921)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33198780
KASP Assay ID:
1641-0494.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGTAAGTTAWTTTTCAACATGTGCGTGTCTCAGTGATAGAAAAAAATA[T/A]CCATYATTTTTCCGCACAATTCCAAGTGACTTCTACCAAGCAAAAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064153 Nonsense 436 748 5 5
Genomic Location (Zv9):
Chromosome 18 (position 31403224)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33200083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACAACCGGTACTGTTATCTAATTYAACTGTATAATTTWTACACAATTT[A/T]AACTAGCTAAATATTGTCATAATTGTAATTCTTTTATAGGAGCAGCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064153 Nonsense 461 748 5 5
Genomic Location (Zv9):
Chromosome 18 (position 31403300)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33200159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTCTTTTATAGGAGCAGCAGACTGCACTCTTTGTCCTAAAGAATACT[G/A]GTCAAATGAAAGACGGGACAAGTGTCTTGTGAAAACAATAGAGTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2984
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064153 Nonsense 578 748 5 5
Genomic Location (Zv9):
Chromosome 18 (position 31403650)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33200509
KASP Assay ID:
554-3339.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCATTTCTTGTGTTTTGGGGAAGACCATAGTAGTTGTCACAGCTTTC[A/T]GAGCCACATTACCAGGAAATAAATTGTCTGGTAAGTTTGGGCCAGTACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link