ENSDARG00000088027

Ensembl ID:
ENSDARG00000088027

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21410 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122910 Nonsense 137 291 2 3
Genomic Location:
Chromosome 9 (position 543704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTCATCATTCACCTGCGTCTGCACACCGGGGAACGGCCCTTTAAGTG[T/A]GATAAATGTGGAAAAGCATTCCGCACGTCAGCTCATCTGCTGAATCACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wrekh6rn