LOC100007492

Ensembl ID:
ENSDARG00000088026
Mouse Orthologue:
Pik3r6
Mouse Description:
phosphoinositide-3-kinase, regulatory subunit 6 Gene [Source:MGI Symbol;Acc:MGI:2144613]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33842 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121737 Essential Splice Site 532 777 15 23
Genomic Location (Zv9):
Chromosome 6 (position 19873788)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23645481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTACAAACTGTAAATGCTAAAACCTCTTCCTTTTTTTTCAACCTTCC[A/G]GTCAAGCATTGGTAAACCGCAAGAGCCTGACCTTTTCTTAGCTGACATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link