Q8MHB6_DANRE

Ensembl ID:
ENSDARG00000088022
Description:
MHC class I antigen [Source:UniProtKB/TrEMBL;Acc:Q8MHB6]
Human Orthologues:
AL645933.1, AZGP1, FCGRT, HFE, MICB, MR1
Human Descriptions:
alpha-2-glycoprotein 1, zinc-binding [Source:HGNC Symbol;Acc:910]
Fc fragment of IgG, receptor, transporter, alpha [Source:HGNC Symbol;Acc:3621]
hemochromatosis [Source:HGNC Symbol;Acc:4886]
major histocompatibility complex, class I-related [Source:HGNC Symbol;Acc:4975]
MHC class I polypeptide-related sequence A isoform 2 (MICA*00801) precursor [Source:RefSeq peptide;
MHC class I polypeptide-related sequence B [Source:HGNC Symbol;Acc:7091]
Mouse Orthologues:
Azgp1, CR974466.3, Fcgrt, Gm11127, Gm7030, Gm8815, Gm8909, H2-Bl, H2-D1, H2-gs10, H2-K1, H2-K2, H2-M2, H2-M3, H2-Q10, H2-Q2, H2-Q6, H2-Q7, H2-Q8, H2-T10, H2-T22, H2-T23, H2-T3, Hfe, Mill1, Mill2, Mr1
Mouse Descriptions:
alpha-2-glycoprotein 1, zinc Gene [Source:MGI Symbol;Acc:MGI:103163]
Fc receptor, IgG, alpha chain transporter Gene [Source:MGI Symbol;Acc:MGI:103017]
hemochromatosis Gene [Source:MGI Symbol;Acc:MGI:109191]
histocompatibility 2, blastocyst Gene [Source:MGI Symbol;Acc:MGI:892004]
histocompatibility 2, D region locus 1 Gene [Source:MGI Symbol;Acc:MGI:95896]
histocompatibility 2, K region locus 2 Pseudogene [Source:MGI Symbol;Acc:MGI:95906]
histocompatibility 2, K1, K region Gene [Source:MGI Symbol;Acc:MGI:95904]
histocompatibility 2, M region locus 2 Gene [Source:MGI Symbol;Acc:MGI:95914]
histocompatibility 2, M region locus 3 Gene [Source:MGI Symbol;Acc:MGI:95915]
histocompatibility 2, Q region locus 10 Gene [Source:MGI Symbol;Acc:MGI:95929]
histocompatibility 2, Q region locus 2 [Source:RefSeq peptide;Acc:NP_034522]
histocompatibility 2, Q region locus 2 Gene [Source:MGI Symbol;Acc:MGI:95931]
histocompatibility 2, Q region locus 6 Gene [Source:MGI Symbol;Acc:MGI:95935]
histocompatibility 2, Q region locus 7 Gene [Source:MGI Symbol;Acc:MGI:95936]
histocompatibility 2, Q region locus 8 Gene [Source:MGI Symbol;Acc:MGI:95937]
histocompatibility 2, T region locus 10 Gene [Source:MGI Symbol;Acc:MGI:95942]
histocompatibility 2, T region locus 22 Gene [Source:MGI Symbol;Acc:MGI:95956]
histocompatibility 2, T region locus 23 Gene [Source:MGI Symbol;Acc:MGI:95957]
histocompatibility 2, T region locus 3 Gene [Source:MGI Symbol;Acc:MGI:95959]
major histocompatibility complex, class I-related Gene [Source:MGI Symbol;Acc:MGI:1195463]
MHC class I like protein GS10 Gene [Source:MGI Symbol;Acc:MGI:3808875]
MHC I like leukocyte 1 Gene [Source:MGI Symbol;Acc:MGI:2179988]
MHC I like leukocyte 2 Gene [Source:MGI Symbol;Acc:MGI:2179989]
predicted gene 11127 Gene [Source:MGI Symbol;Acc:MGI:3779381]
predicted gene 7030 Pseudogene [Source:MGI Symbol;Acc:MGI:3647514]
predicted gene 8815 Pseudogene [Source:MGI Symbol;Acc:MGI:3648635]
predicted gene 8909 Gene [Source:MGI Symbol;Acc:MGI:3704134]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39962 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105021 Nonsense 304 371 4 6
Genomic Location (Zv9):
Chromosome 3 (position 508249)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATGATTGCTACATGACCCACAGGACCTTAAAAGGGCCGGTTATTGCC[A/T]GATGGGGTAATTAAAGCAGTTACAGCATGCTTAGACAGAAATAGTCTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link