ENSDARG00000088021

Ensembl ID:
ENSDARG00000088021

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa429 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa429
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129159 Nonsense 12 132 2 3
Genomic Location:
Chromosome 7 (position 71438666)
KASP Assay ID:
554-0195.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTGTCTCTCAGCAGATTCGTCTGAGCAGATATATTAAGGAATATATG[T/A]TGTCAATCACTGTCGCATCTGTTGAGCACAAGAACACTGGCCAATGTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sdruyy9z