LOC561000

Ensembl ID:
ENSDARG00000088018
Human Orthologue:
LTBR
Human Description:
lymphotoxin beta receptor (TNFR superfamily, member 3) [Source:HGNC Symbol;Acc:6718]
Mouse Orthologue:
Ltbr
Mouse Description:
lymphotoxin B receptor Gene [Source:MGI Symbol;Acc:MGI:104875]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42762 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44855 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121533 Essential Splice Site 11 299 1 8
Genomic Location (Zv9):
Chromosome 16 (position 34198800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31736770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGACCACGGCAAGATGGGAGACGATAAATGCCAAAAATGTCCGAAAG[G/A]TGAGATTTTCATATCATTTCTGTACAAAAGAACGATTTGAGAAGACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121533 Essential Splice Site 53 299 2 8
Genomic Location (Zv9):
Chromosome 16 (position 34201110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGGAAAACAGGATGACCGAGTGTCGACCCTGCAGAAAGTGCACCAGCG[G/A]TAATTTCACATTCATTTACTCTTATTATGATTTACTTGACATTATGCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link