LOC561000

Ensembl ID:
ENSDARG00000088018
Human Orthologue:
LTBR
Human Description:
lymphotoxin beta receptor (TNFR superfamily, member 3) [Source:HGNC Symbol;Acc:6718]
Mouse Orthologue:
Ltbr
Mouse Description:
lymphotoxin B receptor Gene [Source:MGI Symbol;Acc:MGI:104875]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42762 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121533 Essential Splice Site 11 299 1 8
Genomic Location (Zv9):
Chromosome 16 (position 34198800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31736770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGACCACGGCAAGATGGGAGACGATAAATGCCAAAAATGTCCGAAAG[G/A]TGAGATTTTCATATCATTTCTGTACAAAAGAACGATTTGAGAAGACCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link