LOC100332429

Ensembl ID:
ENSDARG00000088017
Human Orthologues:
C1orf168, PRAM1
Human Descriptions:
chromosome 1 open reading frame 168 [Source:HGNC Symbol;Acc:27295]
PML-RARA regulated adaptor molecule 1 [Source:HGNC Symbol;Acc:30091]
Mouse Orthologues:
1700024P16Rik, Pram1
Mouse Descriptions:
PML-RAR alpha-regulated adaptor molecule 1 Gene [Source:MGI Symbol;Acc:MGI:3576625]
RIKEN cDNA 1700024P16 gene Gene [Source:MGI Symbol;Acc:MGI:2685466]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14989 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105622 Essential Splice Site 115 219 4 9
Genomic Location:
Chromosome 11 (position 5630625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATGATGACGTGGACCATGACTTTCCTCCTCCCCCTCCAGAGATCAGG[T/C]TTCTATTCTCTTTATNNNNNTMTCATTTTCTTAACAAATAGACCTCAGTTTTAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Resistin levels : Genome-wide association analysis identifies TYW3/CRYZ and NDST4 loci associated with circulating resistin levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/olka2p6z