LOC100332633

Ensembl ID:
ENSDARG00000088011
Human Orthologue:
FAM19A2
Human Description:
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2 [Source:HGNC Symbol;Acc:2
Mouse Orthologue:
Fam19a2
Mouse Description:
family with sequence similarity 19, member A2 Gene [Source:MGI Symbol;Acc:MGI:2143691]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30534 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114283 Nonsense 70 94 2 3
ENSDART00000128989 Nonsense 74 96 2 2
Genomic Location (Zv9):
Chromosome Zv9_NA123 (position 15736)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149739.1 15736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGAAGTGGTGGTGTCAGATGCAGCCGTGTCTGGATGGTGAAGAGTG[T/A]AAAGTTCTGCCGGATCTGAAAGGATGGAGCTGCGCCACCGGAAACAAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link