pabpn1l

Ensembl ID:
ENSDARG00000087996
ZFIN ID:
ZDB-GENE-080709-5
Human Orthologue:
PABPN1L
Human Description:
poly(A) binding protein, nuclear 1-like (cytoplasmic) [Source:HGNC Symbol;Acc:37237]
Mouse Orthologue:
Pabpn1l
Mouse Description:
poly(A)binding protein nuclear 1-like Gene [Source:MGI Symbol;Acc:MGI:2685954]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41038 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125275 Essential Splice Site 44 163 3 6
ENSDART00000131923 Essential Splice Site 44 163 4 7
ENSDART00000135304 Essential Splice Site 73 192 4 7
ENSDART00000147792 Essential Splice Site 44 162 4 7
Genomic Location (Zv9):
Chromosome 7 (position 56905586)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55340912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTGTATGGTTTGCGGTGTATGTTTATGGACTATTGGTTGCTTTGCA[G/A]GTGGATTATGGAGCAACTGCAGACGAATTGGAGATGTACTTTAATAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link