ENSDARG00000087994

Ensembl ID:
ENSDARG00000087994
Human Orthologue:
PRPF39
Human Description:
PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20314]
Mouse Orthologue:
Prpf39
Mouse Description:
PRP39 pre-mRNA processing factor 39 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:104602]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22539 Nonsense Available for shipment Available now
sa35754 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130291 Nonsense 591 616 14 16
Genomic Location (Zv9):
Chromosome 14 (position 48433012)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46504330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTGATGGGCGGAGACATGAGTGGGTCATATGGAAACTACAGCAGCTG[G/A]TACCAGGTAGATGACGGAGTTTGTGCAAATGTTTAAAATAGCATAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130291 Nonsense 611 616 15 16
Genomic Location (Zv9):
Chromosome 14 (position 48430495)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46501808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCTTATGGCAGCTACCAAAACCCATGGAGCCAGTACAGTCAGTACTA[T/A]CCTCCAAGCTAAAACCCTTCAGAGACGGAGATCTGGATCCGCTCTGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link