LOC799320

Ensembl ID:
ENSDARG00000087985
Human Orthologue:
ZNF365
Human Description:
zinc finger protein 365 [Source:HGNC Symbol;Acc:18194]
Mouse Orthologue:
Zfp365
Mouse Description:
zinc finger protein 365 Gene [Source:MGI Symbol;Acc:MGI:2143676]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39174 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129873 Essential Splice Site 297 345 3 4
Genomic Location (Zv9):
Chromosome 17 (position 43680961)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43645636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGCCTCTGCCATCAGAGCTCGCTCCACAAAGAATAACACAAAGCAG[G/A]TATGACATTTAACTCAGTAATTCACATAACCTTCTTTTAAGCCACAATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
  • Breast cancer: Genome-wide association study identifies breast cancer risk variant at 10q21.2: results from the Asia Breast Cancer Consortium. (View Study)
  • Breast cancer: Genome-wide association study identifies five new breast cancer susceptibility loci. (View Study)
  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
  • Crohn's disease: A genome-wide association study on a southern European population identifies a new Crohn's disease susceptibility locus at RBX1-EP300. (View Study)
  • Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)
  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Ewing sarcoma: Common variants near TARDBP and EGR2 are associated with susceptibility to Ewing sarcoma. (View Study)
  • Intelligence: Genome-wide association study of intelligence: additive effects of novel brain expressed genes. (View Study)
  • Mammographic density: Common variants in ZNF365 are associated with both mammographic density and breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link