KIAA0355 (1 of 2)

Ensembl ID:
ENSDARG00000087977
Description:
KIAA0355 [Source:HGNC Symbol;Acc:29016]
Human Orthologue:
KIAA0355
Human Description:
KIAA0355 [Source:HGNC Symbol;Acc:29016]
Mouse Orthologue:
4931406P16Rik
Mouse Description:
RIKEN cDNA 4931406P16 gene Gene [Source:MGI Symbol;Acc:MGI:1924311]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35611 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125156 Nonsense 162 214 4 4
Genomic Location (Zv9):
Chromosome 13 (position 52328365)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 447419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCCAGCCAATGGGGCGACTCCATGCAAATGCTACAGTCTCCAGTGTG[G/A]TCGACAGCCAATGACTGCCCTCCATCTTCCGGCTTTCCTTTCACACAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Functional MRI: A genome-wide association study of amygdala activation in youths with and without bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link