or122-2

Ensembl ID:
ENSDARG00000087968
ZFIN ID:
ZDB-GENE-990415-192
Description:
odorant receptor, family E, subfamily 122, member 2 [Source:RefSeq peptide;Acc:NP_571205]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30986 Nonsense Mutation detected in F1 DNA During 2017
sa42477 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123689 Nonsense 106 307 1 1
ENSDART00000123689 Nonsense 106 307 1 1
Genomic Location (Zv9):
Chromosome 15 (position 5158798)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5308851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTTCCTCTCACTGTTTGTCATGCTCAGATATTTGCTTTATACTCTTA[T/A]GCACAAGTAGAATTCTGTAACTTAGCCATGATGTCTTATGACCGGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123689 Nonsense 106 307 1 1
ENSDART00000123689 Nonsense 106 307 1 1
Genomic Location (Zv9):
Chromosome 15 (position 5158798)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5308851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTTCCTCTCACTGTTTGTCATGCTCAGATATTTGCTTTATACTCTTA[T/A]GCACAAGTAGAATTCTGTAACTTAGCCATGATGTCTTATGACCGGTATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link