LPHN2 (4 of 4)

Ensembl ID:
ENSDARG00000087965
Description:
latrophilin 2 [Source:HGNC Symbol;Acc:18582]
Human Orthologue:
LPHN2
Human Description:
latrophilin 2 [Source:HGNC Symbol;Acc:18582]
Mouse Orthologue:
Lphn2
Mouse Description:
latrophilin 2 Gene [Source:MGI Symbol;Acc:MGI:2139714]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19648 Nonsense Mutation detected in F1 DNA During 2014
sa5119 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa19648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129221 Nonsense 79 564 2 11
Genomic Location:
Chromosome 2 (position 1644796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGACACACTAGAGGAAGGAGCGTTTGTGCTGGCGGACAACCTGATC[G/T]AGCCGGCGGTGGTGCGCATGCCTGCAGAAAACATCAGTGAGTCTGAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5119
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129221 Essential Splice Site 403 564 7 11
Genomic Location:
Chromosome 2 (position 1666425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCATTTCAGCTGCCATCGACTACAAGAGCTACGGGACCAAAAAAGCG[T/C]GAGTAATGTTTGTGTTCCCATCAACATATTGAGCTGCGGTTTAATATCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wg9lp5ge