she

Ensembl ID:
ENSDARG00000087956
ZFIN ID:
ZDB-GENE-090915-6
Human Orthologue:
SHE
Human Description:
Src homology 2 domain containing E [Source:HGNC Symbol;Acc:27004]
Mouse Orthologue:
She
Mouse Description:
src homology 2 domain-containing transforming protein E Gene [Source:MGI Symbol;Acc:MGI:1099462]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28648 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129612 Nonsense 130 438 1 6
ENSDART00000142241 Nonsense 130 438 2 7
Genomic Location (Zv9):
Chromosome 16 (position 24768855)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22673171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCCTGCGGACCACCAGCCTGGCTGATGAGTACATGAGCAGAATGATC[A/T]AGGTTAATGATCCAAAATCCAGCCCAGGAGGATCTTCTCCAGACAGCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link