LOC561298

Ensembl ID:
ENSDARG00000087940

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6942 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14970 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127627 Essential Splice Site 209 546 6 14
Genomic Location:
Chromosome 4 (position 18852146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGGACTATGAGACTAAAACTCAGCTGCAGGTSGTCATCTATGCTGTG[G/T]TACGTGAAMGTTTTMATTTAAAAATACAGATTGTTTACGGTTAGACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127627 Nonsense 466 546 12 14
Genomic Location:
Chromosome 4 (position 18849306)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGTCAGGCGAGGCAGCCCATGCTTCGGTAGACATTGAAGTTTTGCAG[A/T]GAGGACAACCAGGTAAAAKCTGTGTGTTCATTCTGATTTTCCWTTAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xslasa0n