LOC561298

Ensembl ID:
ENSDARG00000087940

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6942 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33455 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14970 Nonsense Available for shipment Available now
sa38438 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127627 Essential Splice Site 209 546 6 14
Genomic Location:
Chromosome 4 (position 18852146)
KASP Assay ID:
554-5064.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGGACTATGAGACTAAAACTCAGCTGCAGGTSGTCATCTATGCTGTG[G/T]TACGTGAAMGTTTTMATTTAAAAATACAGATTGTTTACGGTTAGACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127627 Essential Splice Site 297 546 8 14
Genomic Location:
Chromosome 4 (position 18850477)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGAGACAAGAACATACTGACCCCTCTAGTCTACAGCATTCTGTCAGG[T/C]GAGTTTACTGTACAGTACAGTTATTGACTGTTTAACCTATATTACTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127627 Nonsense 466 546 12 14
Genomic Location:
Chromosome 4 (position 18849306)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGTCAGGCGAGGCAGCCCATGCTTCGGTAGACATTGAAGTTTTGCAG[A/T]GAGGACAACCAGGTAAAAKCTGTGTGTTCATTCTGATTTTCCWTTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127627 Nonsense 468 546 12 14
Genomic Location:
Chromosome 4 (position 18849300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCGAGGCAGCCCATGCTTCGGTAGACATTGAAGTTTTGCAGAGAGGA[C/T]AACCAGGTAAAAGCTGTGTGTTCATTCTGATTTTCCTTTAAATAAAGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link