LOC100331576

Ensembl ID:
ENSDARG00000087915

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19377 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126695 Essential Splice Site 792 962 6 7
Genomic Location (Zv9):
Chromosome Zv9_scaffold3498 (position 43214)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149690.1 43214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCATGGAGGAGAGAAGAGAATTACAGCAGGACTGCACAAATGTAGGA[C/T]TACACACACACTCACACACACACACATAAGTTCCCTCTCTCTCTAACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link