NDUFA4L2 (1 of 2)

Ensembl ID:
ENSDARG00000087907
Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 [Source:HGNC Symbol;Acc:29836]
Human Orthologue:
NDUFA4L2
Human Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 [Source:HGNC Symbol;Acc:29836]
Mouse Orthologue:
Ndufa4l2
Mouse Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene [Source:MGI Symbol;Acc:MGI:3039567

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12553 Nonsense Available for shipment Available now
sa13088 Nonsense Available for shipment Available now
sa12542 Nonsense Available for shipment Available now
sa18859 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
Genomic Location (Zv9):
Chromosome 6 (position 59188993)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59275787
KASP Assay ID:
2259-8306.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTGAAAGCTGAAGWTGGAGAWCCTCAGAATGAWGCAYCGGCAGGCT[A/T]AAAAACACCCCGGGGTGAGTCCAGATTCATGATCAAAATCAAGGTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
Genomic Location (Zv9):
Chromosome 6 (position 59188993)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59275787
KASP Assay ID:
2259-8306.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTGAAAGCTGAAGWTGGAGAWCCTCAGAATGAWGCAYCGGCAGGCT[A/T]AAAAACACCCCGGGGTGAGTCCAGATTCATGATCAAAATCAAGGTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
Genomic Location (Zv9):
Chromosome 6 (position 59188993)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59275787
KASP Assay ID:
2259-8306.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTGAAAGCTGAAGWTGGAGAWCCTCAGAATGAWGCAYCGGCAGGCT[A/T]AAAAACACCCCGGGGTGAGTCCAGATTCATGATCAAAATCAAGGTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
ENSDART00000126870 Nonsense 12 83 1 4
Genomic Location (Zv9):
Chromosome 6 (position 59188993)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59275787
KASP Assay ID:
2259-8306.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTGAAAGCTGAAGATGGAGATCCTCAGAATGATGCACCGGCAGGCT[A/T]AAAAACACCCCGGGGTGAGTCCAGATTCATGATCAAAATCAAGGTTATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link