mib

Ensembl ID:
ENSDARG00000087895
ZFIN ID:
ZDB-GENE-030404-2
Description:
E3 ubiquitin-protein ligase mib1 [Source:UniProtKB/Swiss-Prot;Acc:Q804S5]
Human Orthologue:
MIB1
Human Description:
mindbomb homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:21086]
Mouse Orthologue:
Mib1
Mouse Description:
mindbomb homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443157]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31118 Nonsense Mutation detected in F1 DNA During 2017
sa44378 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128234 Nonsense 168 570 3 11
Genomic Location (Zv9):
Chromosome Zv9_scaffold3504 (position 58964)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4240223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTGCAGGAGGACGAGTGGTGCGAGGGGTGGATTGGCAATGGGAGGAT[C/T]AGGATGGCGGGAATGGAAGAAGAGGGAAGGTAATGCCTCGACACGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128234 Nonsense 175 570 3 11
Genomic Location (Zv9):
Chromosome Zv9_scaffold3504 (position 58943)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4240244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGAGGGGTGGATTGGCAATGGGAGGATCAGGATGGCGGGAATGGAAGA[A/T]GAGGGAAGGTAATGCCTCGACACGTCTGACTATGCTCACCTTCCTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link