ENSDARG00000087888

Ensembl ID:
ENSDARG00000087888

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8628 Nonsense Mutation detected in F1 DNA During 2014
sa8551 Nonsense Mutation detected in F1 DNA During 2014
sa5768 Nonsense F2 line generated During 2014
sa5460 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128128 Nonsense 233 509 1 1
ENSDART00000128128 Nonsense 233 509 1 1
Genomic Location:
Chromosome 8 (position 1649021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCTCCGTCAATTTGCCTACCTTCCCCCATTTGCCTTCCSTCCATCCT[T/A]ACATCTTTCCACCATYAATCCACCTTCTCTTCRTCCATCCACCTACCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128128 Nonsense 233 509 1 1
ENSDART00000128128 Nonsense 233 509 1 1
Genomic Location:
Chromosome 8 (position 1649021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCTCCGTCAATTTGCCTACCTTCCCCCATTTGCCTTCCSTCCATCCT[T/A]ACATCTTTCCACCATYAATCCACCTTCTCTTCRTCCATCCACCTACCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5768
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128128 Nonsense 379 509 1 1
Genomic Location:
Chromosome 8 (position 1648582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCCCTTCATCCTTCTGCCTTTCCTCCATTCCATCCGCCTTCCCTATA[T/G]CTATCCGCCTACCCTCCATCCATCCGCCTTTCCTTCATCTATCCRCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128128 Nonsense 398 509 1 1
Genomic Location:
Chromosome 8 (position 1648525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTACCCTCCATCCATCCGCCTTTCCTTCATCTATCCRCCTTCCTTCTG[T/A]CCATCCACCTTCCYTCCGTCCATCGTCCTGCTTACCCTCTGTCTATTCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h57r72q5