GPR113 (2 of 2)

Ensembl ID:
ENSDARG00000087870
Description:
G protein-coupled receptor 113 [Source:HGNC Symbol;Acc:18989]
Human Orthologue:
GPR113
Human Description:
G protein-coupled receptor 113 [Source:HGNC Symbol;Acc:18989]
Mouse Orthologue:
Gpr113
Mouse Description:
G protein-coupled receptor 113 Gene [Source:MGI Symbol;Acc:MGI:2685887]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22989 Nonsense Available for shipment Available now
sa11720 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124293 Nonsense 449 1024 12 17
Genomic Location:
Chromosome 17 (position 6348865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGCGGTTATACAGCCACCATGCCTTGTGACAACTCTGGTGTTGGTTG[G/A]AGAACAAGAAAATGCAATGGCACTAGGTGGTCTACTGAAATCTCTACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124293 Essential Splice Site 993 1024 16 17
Genomic Location:
Chromosome 17 (position 6360729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTTACAGCTTTACGATTCTCKAACTTAATTGTACWTCTTTYATTTAA[A/T]GGTTCGTGATGCACTTCTGAAGCGTTTCAAAATCAWGGTTAGTTTGTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/llceab59