si:ch211-11k18.4

Ensembl ID:
ENSDARG00000087869
ZFIN ID:
ZDB-GENE-070912-22

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25250 Nonsense Mutation detected in F1 DNA During 2017
sa6895 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121613 Nonsense 189 450 6 12
ENSDART00000140731 Nonsense 189 450 7 13
ENSDART00000147517 Nonsense 189 196 7 7
Genomic Location (Zv9):
Chromosome 3 (position 26855153)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26049083
KASP Assay ID:
554-7810.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAGGTGAGCTGTGTGACCTGATCCTGGTCTTCTTTGACCCAATGGGA[C/T]AGGCTTTATGCAAGCGCACGCTCAACATTGTTGAGAAGCTGAATGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121613 Nonsense 413 450 11 12
ENSDART00000140731 Nonsense 413 450 12 13
ENSDART00000147517   None 196 None 7
Genomic Location (Zv9):
Chromosome 3 (position 26859247)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26044989
KASP Assay ID:
554-5090.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCTCTCCTCTTACCATATTTAGAACTAAACCGACTCTCTCTGGGAAA[C/T]AAAAGAGACAACTTCAGGAAAAACTGGAGTATGTCCAAGARGTGGTCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link